تحقیق رایگان درباره هيبريد، پلاسميد، پروتئين

دسامبر 29, 2018 0 By mitra7--javid
پایان نامه  

پروتئين CStH
اين تحقيق
pEYS66cbm1
Amp
پلاسميد pBR322 داراي موتيف اتصالي به کادميوم از پروتيئن CadA در جايگاه مجاز موقعيت 66 پروتئين CStH
اين تحقيق
pEYS66cbm2
Amp
پلاسميد pBR322 حاوي اپرون cst نوترکيب بيانکننده موتيف اتصالي به کادميوم در موقعيت 66 پروتئين CStH
اين تحقيق
pEYS79cbm1
Amp
پلاسميد pBR322 داراي موتيف اتصالي به کادميوم از پروتيئن cadA در جايگاه مجاز موقعيت 79 پروتئين CStH
اين تحقيق
pEYS79cb?m1
Amp
پلاسميد pBR322 داراي موتيف تصالي به کادميوم و زنجيره ? همسايه از پروتيئن CAdA در جايگاه مجاز موقعيت 79 پروتئين CStH
اين تحقيق
pEYS79cbm2
Amp
پلاسميد pBR322 حاوي اپرون cst نوترکيب بيانکننده موتيف اتصالي به کادميوم در موقعيت 79 پروتئين CStH
اين تحقيق
pEYS79cb?m2

Amp
پلاسميد pBR322 حاوي اپرون cst نوترکيب بيانکننده بتا-موتيف اتصالي به کادميوم در موقعيت 79 پروتئين CStH
اين تحقيق
pEYS92cbm1
Amp
پلاسميد pBR322 داراي موتيف اتصالي به کادميوم از پروتيئن cadA در جايگاه مجاز موقعيت 92 پروتئين CStH
اين تحقيق
pEYS92cbm2
Amp
پلاسميد pEYS92m1 به همراه ژنهاي تنظيمي بيان پيلي CS3از اپرون cst
اين تحقيق
pEYS107cbm1
Amp
پلاسميد pBR322 داراي موتيف اتصالي به کادميوم از پروتيئن CAdA در جايگاه مجاز موقعيت 107 پروتئين CStH
اين تحقيق
pEYS107cb?m1
Amp
پلاسميد pBR322 داراي بتا-موتيف اتصالي به پروتيئن CAdA در جايگاه مجاز موقعيت 107 پروتئين CStH
اين تحقيق
pEYS107cbm2
Amp
پلاسميد pBR322 حاوي اپرون cst نوترکيب بيان کننده موتيف اتصالي به کادميوم در موقعيت 107 پروتئين CStH
اين تحقيق
pEYS107cb?m2
Amp
پلاسميد pBR322 حاوي اپرون cst نوترکيب بيان کننده بتا-موتيف اتصالي به کادميوم در موقعيت 79 پروتئين CStH
اين تحقيق

7-3-2 اوليگونوکلئوتيدها
به منظور تکثير ژن و ساخت سازوارههاي مورد نياز در اين تحقيق از اوليگونوکلئوتيدهاي ليست شده در جدول 2-9 استفاده شد.
جدول 2-9. مشخصات اوليگونوکلئوتيدهاي استفادهشده در اين تحقيق
کاربرد
توالي
نام پرايمر
تکثير ژن cstH
5´-ACGTATACTGTTGGTCTTAACG-3´
CS3-FF
تکثير ژن cstH
5´-AAGCTTGACTATTTAATGATGCC-3´
CS3-RR
ساخت ژن هيبريد cstH::cbm و ساخت ژن هيبريد cstH::cb?m
5´- GTTGATGGATTAAGCTGTACAAATTGTGCGGCCAAATTTGAACGGAATGTAAAAGAAATTGAGGGTGTAACAGAAGCTATT-3´
80-F2
ساخت ژن هيبريد cstH::cbm
5´-GGGTGTAACAGAAGCTATTAATACTTTGGTGGGTGTTTTGAC-3´
38-F1
ساخت ژن هيبريد cstH::cbm و ساخت ژن هيبريد cstH::cb?m
5´-CAATTTGTACAGCTTAATCCATCAACAGAAACGCCAGTATTGGATAATG-3´
38-R
ساخت ژن هيبريد cstH::cb?m
5´-GGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCACGGTAACAGGTGAAGCAAATACTTTGGTGGGTGTTTTGAC-3´
38b-F1
ساخت ژن هيبريد cstH::cbm
5´-GGGTGTAACAGAAGCTATTAAGAATGGTACAGTAACTTTTGC-3
66-F1
ساخت ژن هيبريد cstH::cbm و ساخت ژن هيبريد cstH::cb?m
5´-CAATTTGTACAGCTTAATCCATCAACAGATGTATCAGAAACATTTGTAC-3´
66-R
ساخت ژن هيبريد cstH::cb?m

5-5GTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCACGGTAACAGGTGAAG CAAAGAATGGTACAGTAACTTTTGC-3

66B-F1

ساخت ژن هيبريد cstH::cbm
5´-GGGTGTAACAGAAGCTATTTCTGCTAGCTTTGCCACCAC-3´
79-F1
ساخت ژن هيبريد cstH::cbm و ساخت ژن هيبريد cstH::cb?m
5´-CAATTTGTACAGCTTAATCCATCAACGTTATTTGTCTCATGTGCAAAAG-3´
79-R
ساخت ژن هيبريد cstH::cbBm
5´-GGGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCACGGTAACAGGTGAAGCA TCTGCTAGCTTTGCCACCAC-3´
79B-F1
ساخت ژن هيبريد cstH::cbm
5´-GGGTGTAACAGAAGCTATTAACATTACGTTGGATAAAAATGC-3´
92-F1
ساخت ژن هيبريد cstH::cbm و ساخت ژن هيبريد cstH::cb?m
5´-CAATTTGTACAGCTTAATCCATCAACGGCATTATCTGTTGAAATGGTG-3´
92-RR
ساخت ژن هيبريد cstH::cbBm
5´-GGGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCACGGTAACAGGTGAAGCAAACATTACGTTGGATAAAAATGC-3´
92B-F1
ساخت ژن هيبريد cstH::cbm
5´- GGGTGTAACAGAAGCTATTACAAATGGGAGTCAGTTGCC-3´
107-FF
ساخت ژن هيبريد cstH::cbm و ساخت ژن هيبريد cstH::cb?m
5´-CAATTTGTACAGCTTAATCCATCAACAGTTTTAACAATCGTATTTCCAG -3´
107-RR
ساخت ژن هيبريد cstH::cb?m
5´-GGGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCACGGTAACAGGTGAAGC ACAAATGGGAGTCAGTTGCC-3´
107B-F1
ايجاد موتاسيون در موقعيت 64 ژن cstH
5´-CATTTGTAGTTTTCTCAATCGTATTTC-3´
CS3-F2 (Forward)
ايجاد موتاسيون در موقعيت 64 ژن cstH
5´-GAAATACGATTGAGAAAACTACAAATG-3´

CS3-F3 (Reverse)
-نوکلئوتيدهاي کدکننده موتيف با حروف درشت و خط زيرين نشاندادهشدهاند. اعداد موجود نشاندهنده موقعيت ورود قطعه (جايگاه مجاز پروتئين) ميباشد. اوليگونوکلئوتيدهاي جهشزاي رفت با حروف (F) و (bF)نشان داده شدهاند که با اوليگونوکلئوتيد معکوس انتها (CS3-RR) بکار رفتهاند و اوليگونوکلئوتيد جهش زاي معکوس (R) با اوليگونوکلئوتيدهاي رفت ابتدا (CS3-FF) بکاررفتهاند. يک جهش نقطهاي در زيرواحد اصلي با دو اوليگونوکلئوتيد مکمل CS3-F2 و CS3-R2که هريک به ترتيب با پرايمرهاي CS3-RR و CS3-FFاستفاده شدند ايجاد گرديد.

8-3-2 کيتهاي آزمايشگاهي
در اين تحقيق از کيتهاي زير استفاده شدهاست.
کيت استخراج پلاسميد (High Pure Plasmid Isolation Kit)، کيت استخراج DNA از ژل آگارز (Agarose Gel DNA Extraction Kit)، کيت خالص سازي محصول PCR ( High Pure PCR Product) (از شرکت Roche).

9-3-2 آنزيمها
آنزيمهايPfu DNA polymerase ، Taq DNA polymerase، RNase A و T4 DNA ligase و آنزيمهاي برشي AocI،BamH1، HindIII و EcoRV از شرکت هاي Fermentase و Rocheتهيه و مطابق دستورالعمل شرکت سازنده و با بافر همراه آنزيم استفاده شدند.
پودر RNase A به غلظت mg/ml 10 در آب استريل حل و در دماي 20- درجه سانتيگراد نگهداري گرديد
10-3-2 نشانگرها
نشانگر وزن مولکولي 100 bp ladder و 1kb Ladder از شرکت Fermentas خريداري گرديدو نشانگر وزن ملکولي پروتئين (Low Molecular Weight Marker) از شرکت Merck تهيه شدند.

11-3-2 محلولها و بافرها
ترکيب محلولهاي مورد نياز براي استخراج DNA پلا
سميدي در مقياس کم به روش ليز قليايي، محلولها و بافرهاي مورد نياز براي الکتروفرز DNA بر روي ژل آگارز و رنگ آميزي آن يعني بافر TAE79، بافر بارگذاري80 DNA و محلول رنگ آميزي81 درپيوست يک به تفضيل آورده شدهاند
محلولها و بافرهاي لازم جهت کار با پروتئينها که در اين تحقيق شامل بافر PBS، محلولها و بافرهاي مورد نياز جهت SDS-PAGE، محلولهاي لازم جهت رنگ آميزي و رنگ بري ژل SDS-PAGE، محلولها و بافرهاي لازم جهت وسترنبلاتينگ، محلولهاي لازم براي سنجش پروتئين در پيوست دو ذکر شدهاست.

12-3-2 محيطهاي کشت
از محيط کشت LB agar82 در تمامي مراحل کلونينگ به منظور کشت باکتريهاي مورد استفاده در اين تحقيق استفاده شد (پيوست سه).
1-12-3-2 محيطهايکشت CFA آگار
براي بيان پيلي CS3 از محيط کشت CFA83 آگار با ترکيبات،10 gr کازامينو اسيد(از شرکت Difco)، 5/. گرم MgSo4.3H2O، 005/. گرمMnCl2. 4 H2O ، 5/1 گرم عصاره مخمر و 20 گرم آگار براي تهيه يک ليتر محيطکشت استفاده شد.

13-3-2 محلول‌هاي مورد نياز براي تهيه سلول‌هاي باكتريايي مستعد84
براي تهيه سلول‌هاي باكتريايي مستعد از محلول هاي 100 ميليمولارCaCl2 و50ميليمولارKCl استفاده شد. اين محلولها توسط اتوكلاو استريل شد. همچنين براي ذخيره سلول‌هاي باكتريايي مستعد از CaCl2100 mM وGlycerol 40% به نسبت مساوي استفاده شد.
14-3-2 محلولهاي مورد نياز به منظور نگهداري باکتريها
براي تهيه ذخيره باكتريايي از محلولهاي زير استفاده شد؛ گلسيرول 15% و پپتون 1% براي نگهداري ذخيره باكتريايي در C?20-، گلسيرول 30% و پپتون 1% براي نگهداري باكتري ها در C? 70 – بكار بردهشد. باكتريها از روي محيطكشت جامد جمعآوري و در محلول‌هاي فوق پراکندهشده و در C?20- يا C?70- نگهداري شدند.
4-2 وسايل و دستگاهها
سانتريفوژ يخچالدار(Sigma 3k 30) ، ترازوي حساس (Metler)،PH متر (JENWAY 30201)، دستگاه حمام آب گرم (Memert)، ميکروفيوژ يخچالدار (Heraeus)، اسپکتروفتومتر (Beckman Du530)، همزن مغناطيسي (Kiagen)، ميکروسکوپ فلورسنت (Olympus)، دستگاه PCR (Techne)، دستگاهUV-Transilluminator ، سانتريفوژ Beckman، اتوکلاو، انکوباتور و دستگاه جذباتمي (Shimadzu AA670/G)

5-2 روشها
1-5-2 کشت باکتري
يک کلني منفرد باکتري روي محيط کشتLB Agar (واجد آنتيبيوتيک) گسترش دادهشد و به مدت 16 ساعت در دماي 37 °C انکوبه گرديد(Russell, 2001).
2-5-2 استخراج پلاسميد
1-2-5-2 استخراج پلاسميد با روش شکستن قليايي
1- مقدار 5/1 ميليليتر از کشت شبانه (معمولا 16 ساعته) توسط سانتريفوژ با دورrpm 4000 و زمان 5 دقيقه رسوب دادهشد. مايع رويي دور ريخته شد و سپس رسوب باکتري در 200 ميکروليتر از محلولI (Suspension Buffer) سوسپانسيون و به مدت 5 دقيقه در دماي اطاق قرار دادهشد.
2- مقدار 400 ميکروليتر از محلولII (Lysis Buffer) به سوسپانسيون باکتريايي فوق اضافهشد و با چند بار معکوس کردن ويال محتويات آن مخلوط گرديد (در اين مرحله بايد از ورتکسکردن و تکان دادن شديد نمونه خودداري نمود، زيرا باعث شکستن DNA کروموزومي و باقي ماندن آن همراه DNA پلاسميدي مي شود) سپس به مدت 5 دقيقه در يخ قرار دادهشد.
3- مقدار 250 ميکروليتر از محلولIII (Neutralization Buffer) به مخلوط فوق اضافه شد، پس از مخلوطکردن به مدت 15 دقيقه در يخ قرار دادهشد.
4- مخلوط فوق با دورrpm 13000، دماي C° 4 و زمان 15 دقيقه سانتريفوژ شد، سپس مايعرويي به ويال جديدي منتقل گرديد. اين مايع حاوي DNA پلاسميدي، کمي پروتئين و RNA ميباشد.
با افزودن RNase ملکولهاي RNA تجزيه ميشوند. RNaseبه مقدار 10 ميکروگرم در ميليليتر به محلول فوق اضافه شد و پس از مخلوط کردن به مدت يک ساعت در دماي °C 37 انکوبه گرديد.
نکته:RNase را ميتوان همراه با محلول(I) و يا محلول(III) نيز اضافه کرد.

3-5-2 استخراج DNA پلاسميدي با استفاده از کيت
در اين روش بر اساس دستورالعمل شرکت سازنده کيت (شرکت Roche) عمل شد.جزئيات روش کار در پيوست چهار آمدهاست.
4-5-2 بازيافت قطعات DNA از روي ژلآگارز با استفاده از کيت
در اين روش بر اساس دستورالعمل شرکت سازنده کيت (Roche) عمل شد. مراحل کار در پيوست پنج شرح داده شدهاست.
5-5-2 خالصسازي محصول PCR با استفاده از کيت
در اين روش نيز بر اساس دستورالعمل شرکت سازنده کيت (Roche) عمل شد و شرح کاملي از روش انجام کار در پيوست شش آمدهاست.
6-5-2 تهيه باکتريهاي مستعد85 براي پذيرش DNA پلاسميد خارجي
دراين تحقيق به روش زير سلولهاي مستعد تهيه گرديد.
1-6-5-2 مستعد سازي باکتريها
1- در مرحله اول سويه باکتري E. coli DH5? در 4 ميليليتر کشت مايع (LB) بهصورت شبانه کشت دادهشده.
2- سپس از اين کشت رقت 1/20 تا 1/100 در حجم 50 ميليليتر تهيه شده و به مدت 2 تا 3 ساعت در حرارت C? 37 با rpm 200 قرارداده تا به OD600=0.6 – 0.9 رسيد.
3- نمونهها براي مدت 10 دقيقه در درون يخ قرارگرفت
4- سپس محيط کشت حاوي باکتري به فالکونهاي استريل 50 منتقل و در دور 3000 rpm و دماي C?4 درجه به مدت 10 دقيقه سانتريفيوژ شد
5- مايع رويي را خاليکرده و فالکن حاوي رسوب باکتري بهصورت وارونه بر روي کاغذ جاذب قرار گرفت و آب آن گرفته شود سپس رسوب را در 25 ميليليتر CaCl2 100 mMسرد پراکندهگرديد و به مدت 30 دقيقه درون يخ انکوبه ميشود.
6- مرحله 4 دوباره تکرار شده و اينبار رسوب حاصل را در 4 ميليليتر از محلول CaCl2 100 mM + 30% Glycerol کاملا